This is an old revision of the document!
PHP RFC: Randomizer Additions
- Version: 1.3
- Date: 2022-10-09
- Author: Joshua Rüsweg, josh@wcflabs.de
- Author: Tim Düsterhus, timwolla@php.net
- Status: Under Discussion
- First Published at: https://wiki.php.net/rfc/randomizer_additions
Introduction
This RFC proposes to add new “building block” methods to \Random\Randomizer that implement commonly useful operations that are either verbose or very hard to implement in userland.
Generating a random string containing specific characters is a common use case to generate random identifiers, voucher codes, numeric strings that exceed the range of an integer and more. Implementing this operation in userland requires selecting random offsets within an input string in a loop and thus requires multiple lines of code for what effectively is a very simple operation. It is also easy to introduce subtle bugs, for example by introducing an off-by-one error with regard to the maximum string index by forgetting to subtract one from the string length. The obvious implementation that uses Randomizer::getInt()
to select the offsets is also inefficient as it requires at least one call to the engine per character, whereas a 64 Bit engine could generate randomness for 8 characters at once.
Generating a random floating point value is also a useful building block, for example to generate a random boolean with a specific chance. Doing this in userland correctly is somewhere between non-trivial and impossible. The obvious implementation, dividing a random integer retrieved using Randomizer::getInt()
by another integer easily results in a bias, because of rounding errors and the decreasing density of floats for larger absolute values.
Proposal
Add three new methods \Random\Randomizer
and one enum accompanying one method:
namespace Random; final class Randomizer { // […] public function getBytesFromString(string $string, int $length): string {} public function nextFloat(): float {} public function getFloat( float $min, float $max, IntervalBoundary $boundary = IntervalBoundary::ClosedOpen ): float {} } enum IntervalBoundary { case ClosedOpen; case ClosedClosed; case OpenClosed; case OpenOpen; }
getBytesFromString()
The method allows you to generate a string with a given length that consists of randomly selected bytes from a given string.
Parameters
string $string
The string from which random bytes are selected.
Note:
The string may contain duplicate bytes. When bytes are duplicated the chance of a value being selected is equal to its proportion within the string. If each byte only appears once, the bytes will be uniformly selected.
int $length
The length of the output string.
Return Value
A random string with the length of the parameter $length
containing only bytes from the parameter $string
.
Examples
1. A random domain name.
<?php $randomizer = new \Random\Randomizer(); var_dump(sprintf( "%s.example.com", $randomizer->getBytesFromString('abcdefghijklmnopqrstuvwxyz0123456789', 16) )); // string(28) "xfhnr0z6ok5fdlbz.example.com"
2. A numeric backup code for multi-factor authentication.
<?php $randomizer = new \Random\Randomizer(); var_dump( implode('-', str_split($randomizer->getBytesFromString('0123456789', 20), 5)) ); // string(23) "09898-46592-79230-33336"
3. An arbitrary precision decimal number.
<?php $randomizer = new \Random\Randomizer(); // Note that trailing zeros might be returned, but all // possible decimals are distinct. var_dump(sprintf( '0.%s', $randomizer->getBytesFromString('0123456789', 30) )); // string(30) "0.217312509790167227890877670844"
4. A random string where each character has a 75% chance of being 'a' and 25% chance of being 'b'.
<?php $randomizer = new \Random\Randomizer(); var_dump( $randomizer->getBytesFromString('aaab', 16) ); // string(16) "baabaaaaaaababaa"
5. A random DNA sequence.
<?php $randomizer = new \Random\Randomizer(); var_dump( $randomizer->getBytesFromString('ACGT', 30) ); // string(30) "CGTAGATCGTTCTGATAGAAGCTAACGGTT"
getFloat()
The method returns a float between $min
and $max
. Whether the interval boundaries are open or closed (i.e. whether $min
and $max
are possible results) depends on the value of the $boundary
parameter. The default is the half-open interval [$min, $max), i.e. including the lower and excluding the upper bound. The returned values are uniformly selected and evenly distributed within the configured interval.
Evenly distributed means that each possible subinterval contains the same number of possible values as each other identically sized subinterval. As an example when calling ->getFloat(0, 1, IntervalBoundary::ClosedOpen)
a return value less than 0.5
is equally likely as a return value that is at least 0.5
. A return value less than 0.1
will happen in 10% of the cases, as will a return value that is at least 0.9
.
The algorithm used is the γ-section algorithm as published in: Drawing Random Floating-Point Numbers from an Interval. Frédéric Goualard, ACM Trans. Model. Comput. Simul., 32:3, 2022. https://doi.org/10.1145/3503512
Parameters
float $min
The lower bound of the interval of possible return values.
float $max
The upper bound of the interval of possible return values.
\Random\IntervalBoundary $boundary = \Random\IntervalBoundary::ClosedOpen
- ClosedOpen (default):
$min
may be returned,$max
may not. - ClosedClosed:
$min
and$max
both may be returned. - OpenClosed:
$min
may not be returned,$max
may. - OpenOpen: Neither
$min
, nor$max
may be returned.
Return Value
A random float, such that:
- ClosedOpen (default):
$float >= $min && $float < $max
- ClosedClosed:
$float >= $min && $float <= $max
- OpenClosed:
$float > $min && $float <= $max
- OpenOpen:
$float > $min && $float < $max
Examples
1. Generate a random latitude and longitude:
<?php $randomizer = new \Random\Randomizer(); // Note that the latitude granularity is double the // longitude's granularity. // // For the latitude the value may be both -90 and 90. // For the longitude the value may be 180, but not -180, because // -180 and 180 refer to the same longitude. var_dump(sprintf( "Lat: %+.6f Lng: %+.6f", $randomizer->getFloat(-90, 90, \Random\IntervalBoundary::ClosedClosed), $randomizer->getFloat(-180, 180, \Random\IntervalBoundary::OpenClosed), )); // string(32) "Lat: -51.742529 Lng: +135.396328"
nextFloat()
This method is equivalent to ->getFloat(0, 1, \Random\IntervalBoundary::ClosedOpen)
. The internal implementation is simpler and faster and it does not require explicit parameters for the common case of the [0, 1) interval.
Return Value
A random float, such that $float >= 0 && $float < 1
.
Examples
1. Simulate a coinflip:
<?php $randomizer = new \Random\Randomizer(); var_dump( $randomizer->nextFloat() < 0.5 ); // bool(true)
2. Get true at a 10% chance:
<?php $randomizer = new \Random\Randomizer(); var_dump( $randomizer->nextFloat() < 0.1 ); // bool(false)
Backward Incompatible Changes
None, since the current implementation of the Randomizer class is final and cannot be modified by the user.
Proposed PHP Version(s)
Next PHP 8.x
RFC Impact
To SAPIs
None.
To Existing Extensions
None.
To Opcache
None.
New Constants
None.
php.ini Defaults
None.
Open Issues
- Shall an option be added to getFloat() that changes the logic to select from [$min, $max] (i.e. allowing the maximum to be returned)?
Unaffected PHP Functionality
The only affected functionality is the Randomizer class that receives new methods. These methods might be visible with Reflection. Everything else is unaffected.
Patches and Tests
- Implementation of
getBytesFromString()
: https://github.com/php/php-src/pull/9664
These implementations are fully functional.
References
- First discussion on the mailing list: https://externals.io/message/118762
- RFC discussion: https://externals.io/message/118810
Changelog
- 1.3: Rename the third getFloat() parameter from $bounds to $boundary to be consistent with the enum name.
- 1.2: Rename GetFloatBounds to IntervalBoundary.
- 1.1: Renames getBytesFromAlphabet to getBytesFromString, add GetFloatBounds enum.