rfc:randomizer_additions

This is an old revision of the document!


PHP RFC: Randomizer Additions

Introduction

This RFC proposes to add new “building block” methods to \Random\Randomizer that implement commonly useful operations that are either verbose or very hard to implement in userland.

Generating a random string containing specific characters is a common use case to generate random identifiers, voucher codes, numeric strings that exceed the range of an integer and more. Implementing this operation in userland requires selecting random offsets within an input string in a loop and thus requires multiple lines of code for what effectively is a very simple operation. It is also easy to introduce subtle bugs, for example by introducing an off-by-one error with regard to the maximum string index by forgetting to subtract one from the string length. The obvious implementation that uses Randomizer::getInt() to select the offsets is also inefficient as it requires at least one call to the engine per character, whereas a 64 Bit engine could generate randomness for 8 characters at once.

Generating a random floating point value is also a useful building block, for example to generate a random boolean with a specific chance. Doing this in userland correctly is somewhere between non-trivial and impossible. The obvious implementation, dividing a random integer retrieved using Randomizer::getInt() by another integer easily results in a bias, because of rounding errors and the decreasing density of floats for larger absolute values.

Proposal

Add three new methods to \Random\Randomizer:

namespace Random;
 
final class Randomizer {
    // […]
    public function getBytesFromString(string $string, int $length): string {}
    public function nextFloat(): float {}
    public function getFloat(
        float $min,
        float $max,
        Randomizer\GetFloatBounds $bounds = Randomizer\GetFloatBounds::ClosedOpen
    ): float {}
}
 
namespace Random\Randomizer;
 
enum GetFloatBounds {
    case ClosedOpen;
    case ClosedClosed;
    case OpenClosed;
    case OpenOpen;
}

getBytesFromString()

The method allows you to generate a string with a given length that consists of randomly selected bytes from a given string.

Parameters

string $string

The string from which random bytes are selected.

Note:

The string may contain duplicate bytes. When bytes are duplicated the chance of a value being selected is equal to its proportion within the string. If each byte only appears once, the bytes will be uniformly selected.

int $length

The length of the output string.

Return Value

A random string with the length of the parameter $length containing only bytes from the parameter $string.

Examples

1. A random domain name.

<?php
$randomizer = new \Random\Randomizer();
 
var_dump(sprintf(
    "%s.example.com",
    $randomizer->getBytesFromString('abcdefghijklmnopqrstuvwxyz0123456789', 16)
)); // string(28) "xfhnr0z6ok5fdlbz.example.com"

2. A numeric backup code for multi-factor authentication.

<?php
$randomizer = new \Random\Randomizer();
 
var_dump(
    implode('-', str_split($randomizer->getBytesFromString('0123456789', 20), 5))
); // string(23) "09898-46592-79230-33336"

3. An arbitrary precision decimal number.

<?php
$randomizer = new \Random\Randomizer();
 
// Note that trailing zeros might be returned, but all
// possible decimals are distinct.
var_dump(sprintf(
    '0.%s',
    $randomizer->getBytesFromString('0123456789', 30)
)); // string(30) "0.217312509790167227890877670844"

4. A random string where each character has a 75% chance of being 'a' and 25% chance of being 'b'.

<?php
$randomizer = new \Random\Randomizer();
 
var_dump(
    $randomizer->getBytesFromString('aaab', 16)
); // string(16) "baabaaaaaaababaa"

5. A random DNA sequence.

<?php
$randomizer = new \Random\Randomizer();
 
var_dump(
    $randomizer->getBytesFromString('ACGT', 30)
); // string(30) "CGTAGATCGTTCTGATAGAAGCTAACGGTT"

getFloat()

The method returns a float between $min and $max. Whether the interval bounds are open or closed (i.e. whether $min and $max are possible results) depends on the value of the $bounds parameter. The default is the half-open interval [$min, $max), i.e. including the lower and excluding the upper bound. The returned values are uniformly selected and evenly distributed within the configured interval.

Evenly distributed means that each possible subinterval contains the same number of possible values as each other identically sized subinterval. As an example when calling ->getFloat(0, 1, GetFloatBounds::ClosedOpen) a return value less than 0.5 is equally likely as a return value that is at least 0.5. A return value less than 0.1 will happen in 10% of the cases, as will a return value that is at least 0.9.

The algorithm used is the γ-section algorithm as published in: Drawing Random Floating-Point Numbers from an Interval. Frédéric Goualard, ACM Trans. Model. Comput. Simul., 32:3, 2022. https://doi.org/10.1145/3503512

Parameters

float $min

The lower bound of the interval of possible return values.

float $max

The upper bound of the interval of possible return values.

Random\Randomizer\GetFloatBounds $bounds = Random\Randomizer\GetFloatBounds::ClosedOpen

  • ClosedOpen (default): $min may be returned, $max may not.
  • ClosedClosed: $min and $max both may be returned.
  • OpenClosed: $min may not be returned, $max may.
  • OpenOpen: Neither $min, nor $max may be returned.

Return Value

A random float, such that:

  • ClosedOpen (default): $float >= $min && $float < $max
  • ClosedClosed: $float >= $min && $float <= $max
  • OpenClosed: $float > $min && $float <= $max
  • OpenOpen: $float > $min && $float < $max

Examples

1. Generate a random latitude and longitude:

<?php
$randomizer = new \Random\Randomizer();
 
// Note that the latitude granularity is double the
// longitude's granularity.
//
// For the latitude the value may be both -90 and 90.
// For the longitude the value may be 180, but not -180, because
// -180 and 180 refer to the same longitude.
var_dump(sprintf(
    "Lat: %+.6f Lng: %+.6f",
    $randomizer->getFloat(-90, 90, Random\Randomizer\GetFloatBounds::ClosedClosed),
    $randomizer->getFloat(-180, 180, Random\Randomizer\GetFloatBounds::OpenClosed),
)); // string(32) "Lat: -51.742529 Lng: +135.396328"

nextFloat()

This method is equivalent to ->getFloat(0, 1, Random\Randomizer\GetFloatBounds::ClosedOpen). The internal implementation is simpler and faster and it does not require explicit parameters for the common case of the [0, 1) interval.

Return Value

A random float, such that $float >= 0 && $float < 1.

Examples

1. Simulate a coinflip:

<?php
$randomizer = new \Random\Randomizer();
 
var_dump(
    $randomizer->nextFloat() < 0.5
); // bool(true)

2. Get true at a 10% chance:

<?php
$randomizer = new \Random\Randomizer();
 
var_dump(
    $randomizer->nextFloat() < 0.1
); // bool(false)

Backward Incompatible Changes

None, since the current implementation of the Randomizer class is final and cannot be modified by the user.

Proposed PHP Version(s)

Next PHP 8.x

RFC Impact

To SAPIs

None.

To Existing Extensions

None.

To Opcache

None.

New Constants

None.

php.ini Defaults

None.

Open Issues

  • Shall an option be added to getFloat() that changes the logic to select from [$min, $max] (i.e. allowing the maximum to be returned)?

Unaffected PHP Functionality

The only affected functionality is the Randomizer class that receives new methods. These methods might be visible with Reflection. Everything else is unaffected.

Patches and Tests

These implementations are fully functional.

References

Changelog

  • 1.1: Renames getBytesFromAlphabet to getBytesFromString, add GetFloatBounds enum.
rfc/randomizer_additions.1666983830.txt.gz · Last modified: 2022/10/28 19:03 by timwolla